Skip to content

Server query

In the following, we assume that a kmindex-server is running at 127.0.0.1 on port 8080.

Method Description Path
GET Index informations /kmindex/infos
POST Index query /kmindex/query

Accessing index information

Request 

curl -X GET http://127.0.0.1:8080/kmindex/infos

Response 

{
    "index": {
        "D1": {
            "bloom_size": 10000128,
            "index_size": 9,
            "minim_size": 10,
            "nb_partitions": 4,
            "nb_samples": 2,
            "samples": [
                "S1",
                "S2"
            ],
            "smer_size": 25
        },
        "D2": {
            "bloom_size": 10000128,
            "index_size": 9,
            "minim_size": 10,
            "nb_partitions": 4,
            "nb_samples": 2,
            "samples": [
                "S3",
                "S4"
            ],
            "smer_size": 25
        }
    }

Query index

json body

  • index: An array of strings corresponding to the indexes to query.
  • id: A string used as query identifier.
  • seq: An array of strings corresponding to the sequences to query. All sequences are considered as a unique query (same as kmindex query --single-query <STR>).
  • fastx: A string containing sequences in fasta/q format.
  • format: A string in ["json", "tsv"] corresponding to the output format.
  • z: The z parameter, see z help (default: 0).
  • r: A float in \([0,1]\), all ratios greater than r are reported (default: 0).

seq and fastx are mutually exclusive.

Request

curl -X POST http://127.0.0.1:8080/kmindex/query \
     -H 'Content-type: application/json' \
     -d '{"index":["D1"],"seq":["ACGACGACGACGAGACGAGACGACAGCAGACAGAGACATAATATACT"], "id":"ID","z":3}' # (1)!.
  1. To avoid curl to change POST requests to GET on redirection, use --post302.

Response

{
    "D1": {
        "ID": {
            "S1": 1.0,
            "S2": 0.0
        },
    }
}